
                                 tfextract 



Function

   Extract data from TRANSFAC

Description

   The TRANSFAC Database is a commercial database of eukaryotic
   cis-acting regulatory DNA elements and trans-acting factors. It covers
   the whole range from yeast to human.

   An old public domain version is available at:
   ftp://ftp.ebi.ac.uk/pub/databases/transfac/transfac32.tar.Z

   TRANSFAC started in 1988 with a printed compilation (Nucleic Acids
   Res. 16: 1879-1902, 1988) and was transferred into computer-readable
   format in 1990 (BioTechForum - Advances in Molecular Genetics (J.
   Collins, A.J. Driesel, eds.) 4:95-108, 1991). The basic structures of
   Table 1 and 2 of the compilation were taken as the core of the
   emergent database. The aim of the early compilation as well as of the
   TRANSFAC database is:

    1. to guide through a meanwhile overwhelming amount of data in a
       field which is connected to nearly all areas of modern molecular
       biology;
    2. to map the regulatory sites in the individual genes and,
       ultimately, in the genome(s) as a whole;
    3. to develop a tool for the identification of regulatory elements in
       newly unravelled genomic sequences;
    4. to provide a basis for a more comprehensive understanding of how
       the genome governs transcriptional control.

   The program tfextract extracts data from the TRANSFAC database file
   site.dat. This file contains information on individual (putatively)
   regulatory protein binding sites. About half of these refer to sites
   within eukaryotic genes. Just under half of them resulted from
   mutagenesis studies, in vitro selection procedures starting from
   random oligonucleotide mixtures or from specific theoretical
   considerations. And finally, there are about 5% with consensus binding
   sequences given in the IUPAC code, many of them being taken from the
   compilation of Faisst and Meyer (Nucleic Acids Res. 20:3-26, 1992). A
   number of consensi have been generated by the TRANSFAC team, generally
   derived from the profiles stored in the MATRIX table.

   The data is split up by taxonomic groups:

     * Fungi
     * Insects
     * Plants
     * Vertebrates
     * Other

   and placed in individual files:

     * tffungi
     * tfinsect
     * tfplant
     * tfvertebrate
     * tfother

   These files are stored in the EMBOSS data directory, see Data Files
   below.

Usage

   Here is a sample session with tfextract


% tfextract 
Extract data from TRANSFAC
Full pathname of transfac SITE.DAT: site.dat

   Go to the input files for this example
   Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-infile]            infile     Full pathname of transfac SITE.DAT

   Additional (Optional) qualifiers: (none)
   Advanced (Unprompted) qualifiers: (none)
   Associated qualifiers: (none)
   General qualifiers:
   -auto                boolean    Turn off prompts
   -stdout              boolean    Write standard output
   -filter              boolean    Read standard input, write standard output
   -options             boolean    Prompt for standard and additional values
   -debug               boolean    Write debug output to program.dbg
   -verbose             boolean    Report some/full command line options
   -help                boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning             boolean    Report warnings
   -error               boolean    Report errors
   -fatal               boolean    Report fatal errors
   -die                 boolean    Report deaths


   Standard (Mandatory) qualifiers Allowed values Default
   [-infile]
   (Parameter 1) Full pathname of transfac SITE.DAT Input file Required
   Additional (Optional) qualifiers Allowed values Default
   (none)
   Advanced (Unprompted) qualifiers Allowed values Default
   (none)

Input file format

   It reads in the TRANSFAC file site.dat available from:

   ftp://ftp.ebi.ac.uk/pub/databases/transfac/ 

  Input files for usage example

  File: site.dat

AC  R00077
XX
ID  HS$ALBU_01
XX
DT  20.06.90 (created); ewi.
DT  24.08.95 (updated); hiwi.
XX
TY  D
XX
DE  albumin; Gene: G000188.
XX
SQ  tGGTTAGtaattactaa.
XX
SF  -363
ST  -338
XX
BF  T00368; HNF-1A;Quality: 1; Species: human, Homo sapiens.
BF  T00369; HNF-1;Quality: 1; Species: rat, Rattus norvegicus.
BF  T01950; HNF-1B;Quality: 1; Species: human, Homo sapiens.
BF  T01951; HNF-1C;Quality: 1; Species: human, Homo sapiens.
XX
OS  human, Homo sapiens
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; primates
XX
SO  0103; Hep3B
SO  0289; rl
XX
MM  gel retardation
MM  direct gel shift
MM  DNase I footprinting
MM  gel shift competition
MM  affinity chromatography
MM  methylation interference
XX
DR  EMBL: M13075; HSALBEX1(695:711).
XX
RN  [1]
RA  Frain M., Swart G., Monaci P., Nicosia A., Staempfli
RA  S., Frank R., Cortese R.
RT  The liver-specific transcription factor LF-B1 contains
RT  a highly diverged homeobox DNA binding domain
RL  Cell 59:145-157 (1989).
RN  [2]
RA  Frain M., Hardon E., Ciliberto G., Sala-Trepat J. M.
RT  Binding of a liver-specific factor to the human albumin
RT  gene promoter and enhancer
RL  Mol. Cell. Biol. 10:991-999 (1990).
XX
//


  [Part of this file has been deleted for brevity]

DR  EMBL: U11854; MM11854(1931:1941).
XX
RN  [1]
RA  Feinman R., Qiu W. Q., Pearse R. N., Nikolajczyk B.
RA  S., Sen R., Sheffery M., Ravetch J. V.
RT  PU.1 and an HLH family member contribute to the myeloid-specific
RT  transcription of the FcgammaRIIIA promoter
RL  EMBO J. 13:3852-3860 (1994).
XX
//
AC  R04413
XX
ID  MOUSE$FCGR3A_02
XX
DT  14.05.97 (created); ewi.
DT  14.05.97 (updated); ewi.
XX
TY  D
XX
DE  FcgammaRIIIA (low-affinity Fc receptor IIIA for IgG); Gene: G001014.
XX
SQ  TTCCTC.
XX
EL  MRR
XX
SF  -48
ST  -43
XX
BF  T00702; PU.1;Quality: 3; Species: mouse, Mus musculus.
XX
OS  mouse, Mus musculus
OC  eukaryota; animalia; metazoa; chordata; vertebrata;
OC  tetrapoda; mammalia; eutheria; rodentia; myomorpha; muridae; murinae
XX
SO  0495; A20
SO  0848; RAW264.7
XX
MM  direct gel shift
MM  methylation interference
MM  supershift (antibody binding)
XX
DR  EMBL: U11854; MM11854(1971:1976).
XX
RN  [1]
RA  Feinman R., Qiu W. Q., Pearse R. N., Nikolajczyk B.
RA  S., Sen R., Sheffery M., Ravetch J. V.
RT  PU.1 and an HLH family member contribute to the myeloid-specific
RT  transcription of the FcgammaRIIIA promoter
RL  EMBO J. 13:3852-3860 (1994).
XX
//

Output file format

  Output files for usage example

  File: tffungi

Y$ADH1_02            ACAATATGGACTTCCTCTTTTCTGG R04140 T00322; GCR1;Quality: 2;
Species: yeast, Saccharomyces cerevisiae.

  File: tfinsect

  File: tfvertebrate

HS$ALBU_01           tGGTTAGtaattactaa R00077 T01951; HNF-1C;Quality: 1; Specie
s: human, Homo sapiens.
HS$ALBU_02           TTGGCA R00078 T00599; NF-1/L;Quality: 6; Species: rat, Rat
tus norvegicus.
HS$ALBU_03           TGGCA R00079 T00599; NF-1/L;Quality: 6; Species: rat, Ratt
us norvegicus.
HS$ALBU_04           TTAATAAT R00080 T00015; AFP1;Quality: 6; Species: human, H
omo sapiens.
HS$ALBU_05           TCTAGTTAATAATCTACAAT R00081 T00369; HNF-1;Quality: 4; Spec
ies: rat, Rattus norvegicus.
MOUSE$FCGR3A_01      GTCTGCTGACC R04412 T00874; USF;Quality: 2; Species: human,
 Homo sapiens.
MOUSE$FCGR3A_02      TTCCTC R04413 T00702; PU.1;Quality: 3; Species: mouse, Mus
 musculus.

  File: tfplant

  File: tfother

   The output from tfextract is a set of files in the emboss/data
   directory containing reformatted sites from the transfac database.

   These files are used by the tfscan program to search for TRANSFAC
   sites in sequences.

Data files

   EMBOSS data files are distributed with the application and stored in
   the standard EMBOSS data directory, which is defined by the EMBOSS
   environment variable EMBOSS_DATA.

   To see the available EMBOSS data files, run:

% embossdata -showall

   To fetch one of the data files (for example 'Exxx.dat') into your
   current directory for you to inspect or modify, run:

% embossdata -fetch -file Exxx.dat

   Users can provide their own data files in their own directories.
   Project specific files can be put in the current directory, or for
   tidier directory listings in a subdirectory called ".embossdata".
   Files for all EMBOSS runs can be put in the user's home directory, or
   again in a subdirectory called ".embossdata".

   The directories are searched in the following order:
     * . (your current directory)
     * .embossdata (under your current directory)
     * ~/ (your home directory)
     * ~/.embossdata

Notes

   None.

References

     * Nucleic Acids Res. 16: 1879-1902, 1988
     * BioTechForum - Advances in Molecular Genetics (J. Collins,A.J.
       Driesel, eds.) 4:95-108, 1991
     * Nucleic Acids Res. 20:3-26, 1992

Warnings

   None.

Diagnostic Error Messages

   None.

Exit status

   It always exits with a status of 0.

Known bugs

   None.

See also

    Program name                        Description
   aaindexextract Extract data from AAINDEX
   cutgextract    Extract data from CUTG
   printsextract  Extract data from PRINTS
   prosextract    Build the PROSITE motif database for use by patmatmotifs
   rebaseextract  Extract data from REBASE

Author(s)

   Alan Bleasby (ajb  ebi.ac.uk)
   European Bioinformatics Institute, Wellcome Trust Genome Campus,
   Hinxton, Cambridge CB10 1SD, UK

History

   Written Summer 2000 - Alan Bleasby.

Target users

   This program is intended to be used by administrators responsible for
   software and database installation and maintenance.

Comments

   None
