
                                  showorf 



Function

   Pretty output of DNA translations

Description

   Showorf displays a nucleic acid sequence with its protein translation
   in a style suitable for publication. The translation can be done in
   any frame or combination of frames.

   It uses codon frequency files to do the translation. You can specify
   the codon frequency file that you use with the '-cfile' option. The
   default table is 'Ehum.cut'.

Usage

   Here is a sample session with showorf


% showorf 
Pretty output of DNA translations
Input sequence: tembl:paamir
Select Frames To Translate
         0 : None
         1 : F1
         2 : F2
         3 : F3
         4 : R1
         5 : R2
         6 : R3
Select one or more values [1,2,3,4,5,6]: 
Output file [paamir.showorf]: 

   Go to the input files for this example
   Go to the output files for this example

Command line arguments

   Standard (Mandatory) qualifiers:
  [-sequence]          sequence   Sequence USA
   -frames             menu       Select one or more values
  [-outfile]           outfile    Output file name

   Additional (Optional) qualifiers:
   -table              menu       Genetic code to use
   -[no]ruler          boolean    Add a ruler
   -[no]plabel         boolean    Number translations
   -[no]nlabel         boolean    Number DNA sequence

   Advanced (Unprompted) qualifiers:
   -width              integer    Width of screen

   Associated qualifiers:

   "-sequence" associated qualifiers
   -sbegin1            integer    Start of the sequence to be used
   -send1              integer    End of the sequence to be used
   -sreverse1          boolean    Reverse (if DNA)
   -sask1              boolean    Ask for begin/end/reverse
   -snucleotide1       boolean    Sequence is nucleotide
   -sprotein1          boolean    Sequence is protein
   -slower1            boolean    Make lower case
   -supper1            boolean    Make upper case
   -sformat1           string     Input sequence format
   -sdbname1           string     Database name
   -sid1               string     Entryname
   -ufo1               string     UFO features
   -fformat1           string     Features format
   -fopenfile1         string     Features file name

   "-outfile" associated qualifiers
   -odirectory2        string     Output directory

   General qualifiers:
   -auto               boolean    Turn off prompts
   -stdout             boolean    Write standard output
   -filter             boolean    Read standard input, write standard output
   -options            boolean    Prompt for standard and additional values
   -debug              boolean    Write debug output to program.dbg
   -verbose            boolean    Report some/full command line options
   -help               boolean    Report command line options. More
                                  information on associated and general
                                  qualifiers can be found with -help -verbose
   -warning            boolean    Report warnings
   -error              boolean    Report errors
   -fatal              boolean    Report fatal errors
   -die                boolean    Report deaths


   Standard (Mandatory) qualifiers Allowed values Default
   [-sequence]
   (Parameter 1) Sequence USA Readable sequence Required
   -frames Select one or more values
   0 (None)
   1 (F1)
   2 (F2)
   3 (F3)
   4 (R1)
   5 (R2)
   6 (R3)
   1,2,3,4,5,6
   [-outfile]
   (Parameter 2) Output file name Output file <sequence>.showorf
   Additional (Optional) qualifiers Allowed values Default
   -table Genetic code to use
   0 (Standard)
   1 (Standard (with alternative initiation codons))
   2 (Vertebrate Mitochondrial)
   3 (Yeast Mitochondrial)
   4 (Mold, Protozoan, Coelenterate Mitochondrial and
   Mycoplasma/Spiroplasma)
   5 (Invertebrate Mitochondrial)
   6 (Ciliate Macronuclear and Dasycladacean)
   9 (Echinoderm Mitochondrial)
   10 (Euplotid Nuclear)
   11 (Bacterial)
   12 (Alternative Yeast Nuclear)
   13 (Ascidian Mitochondrial)
   14 (Flatworm Mitochondrial)
   15 (Blepharisma Macronuclear)
   16 (Chlorophycean Mitochondrial)
   21 (Trematode Mitochondrial)
   22 (Scenedesmus obliquus)
   23 (Thraustochytrium Mitochondrial)
   0
   -[no]ruler Add a ruler Boolean value Yes/No Yes
   -[no]plabel Number translations Boolean value Yes/No Yes
   -[no]nlabel Number DNA sequence Boolean value Yes/No Yes
   Advanced (Unprompted) qualifiers Allowed values Default
   -width Width of screen Integer 10 or more 50

Input file format

   showorf reads a normal nucleic acid sequence USA.

  Input files for usage example

   'tembl:paamir' is a sequence entry in the example nucleic acid
   database 'tembl'

  Database entry: tembl:paamir

ID   PAAMIR     standard; DNA; PRO; 2167 BP.
XX
AC   X13776; M43175;
XX
SV   X13776.1
XX
DT   19-APR-1989 (Rel. 19, Created)
DT   17-FEB-1997 (Rel. 50, Last updated, Version 22)
XX
DE   Pseudomonas aeruginosa amiC and amiR gene for aliphatic amidase regulation
XX
KW   aliphatic amidase regulator; amiC gene; amiR gene.
XX
OS   Pseudomonas aeruginosa
OC   Bacteria; Proteobacteria; gamma subdivision; Pseudomonadaceae; Pseudomonas
.
XX
RN   [1]
RP   1167-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (16-DEC-1988) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG
.
XX
RN   [2]
RP   1167-2167
RX   MEDLINE; 89211409.
RA   Lowe N., Rice P.M., Drew R.E.;
RT   "Nucleotide sequence of the aliphatic amidase regulator gene of Pseudomona
s
RT   aeruginosa";
RL   FEBS Lett. 246:39-43(1989).
XX
RN   [3]
RP   1-1292
RX   MEDLINE; 91317707.
RA   Wilson S., Drew R.;
RT   "Cloning and DNA seqence of amiC, a new gene regulating expression of the
RT   Pseudomonas aeruginosa aliphatic amidase, and purification of the amiC
RT   product.";
RL   J. Bacteriol. 173:4914-4921(1991).
XX
RN   [4]
RP   1-2167
RA   Rice P.M.;
RT   ;
RL   Submitted (04-SEP-1991) to the EMBL/GenBank/DDBJ databases.
RL   Rice P.M., EMBL, Postfach 10-2209, Meyerhofstrasse 1, 6900 Heidelberg, FRG
.
XX
DR   SWISS-PROT; P10932; AMIR_PSEAE.
DR   SWISS-PROT; P27017; AMIC_PSEAE.
DR   SWISS-PROT; Q51417; AMIS_PSEAE.


  [Part of this file has been deleted for brevity]

FT                   phenotype"
FT                   /replace=""
FT                   /gene="amiC"
FT   misc_feature    1
FT                   /note="last base of an XhoI site"
FT   misc_feature    648..653
FT                   /note="end of 658bp XhoI fragment, deletion in  pSW3 cause
s
FT                   constitutive expression of amiE"
FT   conflict        1281
FT                   /replace="g"
FT                   /citation=[3]
XX
SQ   Sequence 2167 BP; 363 A; 712 C; 730 G; 362 T; 0 other;
     ggtaccgctg gccgagcatc tgctcgatca ccaccagccg ggcgacggga actgcacgat        6
0
     ctacctggcg agcctggagc acgagcgggt tcgcttcgta cggcgctgag cgacagtcac       12
0
     aggagaggaa acggatggga tcgcaccagg agcggccgct gatcggcctg ctgttctccg       18
0
     aaaccggcgt caccgccgat atcgagcgct cgcacgcgta tggcgcattg ctcgcggtcg       24
0
     agcaactgaa ccgcgagggc ggcgtcggcg gtcgcccgat cgaaacgctg tcccaggacc       30
0
     ccggcggcga cccggaccgc tatcggctgt gcgccgagga cttcattcgc aaccgggggg       36
0
     tacggttcct cgtgggctgc tacatgtcgc acacgcgcaa ggcggtgatg ccggtggtcg       42
0
     agcgcgccga cgcgctgctc tgctacccga ccccctacga gggcttcgag tattcgccga       48
0
     acatcgtcta cggcggtccg gcgccgaacc agaacagtgc gccgctggcg gcgtacctga       54
0
     ttcgccacta cggcgagcgg gtggtgttca tcggctcgga ctacatctat ccgcgggaaa       60
0
     gcaaccatgt gatgcgccac ctgtatcgcc agcacggcgg cacggtgctc gaggaaatct       66
0
     acattccgct gtatccctcc gacgacgact tgcagcgcgc cgtcgagcgc atctaccagg       72
0
     cgcgcgccga cgtggtcttc tccaccgtgg tgggcaccgg caccgccgag ctgtatcgcg       78
0
     ccatcgcccg tcgctacggc gacggcaggc ggccgccgat cgccagcctg accaccagcg       84
0
     aggcggaggt ggcgaagatg gagagtgacg tggcagaggg gcaggtggtg gtcgcgcctt       90
0
     acttctccag catcgatacg cccgccagcc gggccttcgt ccaggcctgc catggtttct       96
0
     tcccggagaa cgcgaccatc accgcctggg ccgaggcggc ctactggcag accttgttgc      102
0
     tcggccgcgc cgcgcaggcc gcaggcaact ggcgggtgga agacgtgcag cggcacctgt      108
0
     acgacatcga catcgacgcg ccacaggggc cggtccgggt ggagcgccag aacaaccaca      114
0
     gccgcctgtc ttcgcgcatc gcggaaatcg atgcgcgcgg cgtgttccag gtccgctggc      120
0
     agtcgcccga accgattcgc cccgaccctt atgtcgtcgt gcataacctc gacgactggt      126
0
     ccgccagcat gggcggggga ccgctcccat gagcgccaac tcgctgctcg gcagcctgcg      132
0
     cgagttgcag gtgctggtcc tcaacccgcc gggggaggtc agcgacgccc tggtcttgca      138
0
     gctgatccgc atcggttgtt cggtgcgcca gtgctggccg ccgccggaag ccttcgacgt      144
0
     gccggtggac gtggtcttca ccagcatttt ccagaatggc caccacgacg agatcgctgc      150
0
     gctgctcgcc gccgggactc cgcgcactac cctggtggcg ctggtggagt acgaaagccc      156
0
     cgcggtgctc tcgcagatca tcgagctgga gtgccacggc gtgatcaccc agccgctcga      162
0
     tgcccaccgg gtgctgcctg tgctggtatc ggcgcggcgc atcagcgagg aaatggcgaa      168
0
     gctgaagcag aagaccgagc agctccagga ccgcatcgcc ggccaggccc ggatcaacca      174
0
     ggccaaggtg ttgctgatgc agcgccatgg ctgggacgag cgcgaggcgc accagcacct      180
0
     gtcgcgggaa gcgatgaagc ggcgcgagcc gatcctgaag atcgctcagg agttgctggg      186
0
     aaacgagccg tccgcctgag cgatccgggc cgaccagaac aataacaaga ggggtatcgt      192
0
     catcatgctg ggactggttc tgctgtacgt tggcgcggtg ctgtttctca atgccgtctg      198
0
     gttgctgggc aagatcagcg gtcgggaggt ggcggtgatc aacttcctgg tcggcgtgct      204
0
     gagcgcctgc gtcgcgttct acctgatctt ttccgcagca gccgggcagg gctcgctgaa      210
0
     ggccggagcg ctgaccctgc tattcgcttt tacctatctg tgggtggccg ccaaccagtt      216
0
     cctcgag                                                                216
7
//

Output file format

   As a sequence with high GC content (from Pseudmonas aeruginosa) PAAMIR
   has several overlapping open reading frames.

   The true ORFs are 1..109 (amiB partial) 135..1292 (amiC) 1289..1879
   (amiR) 1925..end (amiS partial)

  Output files for usage example

  File: paamir.showorf

SHOWORF of PAAMIR from 1 to 2167

           ---------|---------|---------|---------|---------|
         1 ggtaccgctggccgagcatctgctcgatcaccaccagccgggcgacggga 50
F1       1 G  T  A  G  R  A  S  A  R  S  P  P  A  G  R  R  E  17
F2       1  V  P  L  A  E  H  L  L  D  H  H  Q  P  G  D  G  N 17
F3       1   Y  R  W  P  S  I  C  S  I  T  T  S  R  A  T  G   16
R1       9   T  G  S  A  S  C  R  S  S  *  W  W  G  P  S  P   5
R2     106    Y  R  Q  G  L  M  Q  E  I  V  V  L  R  A  V  P  91
R3      38     V  A  P  R  A  D  A  R  D  G  G  A  P  R  R  S 23

           ---------|---------|---------|---------|---------|
        51 actgcacgatctacctggcgagcctggagcacgagcgggttcgcttcgta 100
F1      18  L  H  D  L  P  G  E  P  G  A  R  A  G  S  L  R  T 34
F2      18   C  T  I  Y  L  A  S  L  E  H  E  R  V  R  F  V   33
F3      17 T  A  R  S  T  W  R  A  W  S  T  S  G  F  A  S  Y  33
R1       4 F  Q  V  I  *  R  A  L  R  S  C  S  R  T  R  K  T  31
R2      90  V  A  R  D  V  Q  R  A  Q  L  V  L  P  N  A  E  Y 74
R3      22   S  C  S  R  G  P  S  G  P  A  R  A  P  E  S  R   7

           ---------|---------|---------|---------|---------|
       101 cggcgctgagcgacagtcacaggagaggaaacggatgggatcgcaccagg 150
F1      35   A  L  S  D  S  H  R  R  G  N  G  W  D  R  T  R   50
F2      34 R  R  *  A  T  V  T  G  E  E  T  D  G  I  A  P  G  14
F3      34  G  A  E  R  Q  S  Q  E  R  K  R  M  G  S  H  Q  E 50
R1      30  R  R  Q  A  V  T  V  P  S  S  V  S  P  I  A  G  P 14
R2      73   P  A  S  R  C  D  C  S  L  F  R  I  P  D  C  W   58
R3       6 V  A  S  L  S  L  *  L  L  P  F  P  H  S  R  V  L  398

           ---------|---------|---------|---------|---------|
       151 agcggccgctgatcggcctgctgttctccgaaaccggcgtcaccgccgat 200
F1      51 S  G  R  *  S  A  C  C  S  P  K  P  A  S  P  P  I  13
F2      15  A  A  A  D  R  P  A  V  L  R  N  R  R  H  R  R  Y 31
F3      51   R  P  L  I  G  L  L  F  S  E  T  G  V  T  A  D   66
R1      13   A  A  A  S  R  G  A  T  R  R  F  R  R  *  R  R   49
R2      57 S  R  G  S  I  P  R  S  N  E  S  V  P  T  V  A  S  41
R3     397  L  P  R  Q  D  A  Q  Q  E  G  F  G  A  D  G  G  I 381

           ---------|---------|---------|---------|---------|
       201 atcgagcgctcgcacgcgtatggcgcattgctcgcggtcgagcaactgaa 250
F1      14  S  S  A  R  T  R  M  A  H  C  S  R  S  S  N  *  T 1
F2      32   R  A  L  A  R  V  W  R  I  A  R  G  R  A  T  E   47
F3      67 I  E  R  S  H  A  Y  G  A  L  L  A  V  E  Q  L  N  83
R1      48 Y  R  A  S  A  R  T  H  R  M  A  R  P  R  A  V  S  32
R2      40  I  S  R  E  C  A  Y  P  A  N  S  A  T  S  C  S  F 24
R3     380   D  L  A  R  V  R  I  A  C  Q  E  R  D  L  L  Q   365

           ---------|---------|---------|---------|---------|
       251 ccgcgagggcggcgtcggcggtcgcccgatcgaaacgctgtcccaggacc 300
F1       2   A  R  A  A  S  A  V  A  R  S  K  R  C  P  R  T   17


  [Part of this file has been deleted for brevity]

F2       8 N  N  K  R  G  I  V  I  M  L  G  L  V  L  L  Y  V  24
F3      22  I  T  R  G  V  S  S  S  C  W  D  W  F  C  C  T  L 38
R1      53  L  L  L  L  P  I  T  M  M  S  P  S  T  R  S  Y  T 37
R2      73   I  V  L  P  T  D  D  D  H  Q  S  Q  N  Q  Q  V   58
R3       7 C  Y  C  S  P  Y  R  *  *  A  P  V  P  E  A  T  R  7

           ---------|---------|---------|---------|---------|
      1951 tggcgcggtgctgtttctcaatgccgtctggttgctgggcaagatcagcg 2000
F1      16 W  R  G  A  V  S  Q  C  R  L  V  A  G  Q  D  Q  R  32
F2      25  G  A  V  L  F  L  N  A  V  W  L  L  G  K  I  S  G 41
F3      39   A  R  C  C  F  S  M  P  S  G  C  W  A  R  S  A   54
R1      36   P  A  T  S  N  R  L  A  T  Q  N  S  P  L  I  L   21
R2      57 N  A  R  H  Q  K  E  I  G  D  P  Q  Q  A  L  D  A  41
R3       6  Q  R  P  A  T  E  *  H  R  R  T  A  P  C  S  *  R 7

           ---------|---------|---------|---------|---------|
      2001 gtcgggaggtggcggtgatcaacttcctggtcggcgtgctgagcgcctgc 2050
F1      33  S  G  G  G  G  D  Q  L  P  G  R  R  A  E  R  L  R 49
F2      42   R  E  V  A  V  I  N  F  L  V  G  V  L  S  A  C   57
F3      55 V  G  R  W  R  *  S  T  S  W  S  A  C  *  A  P  A  3
R1      20 P  R  S  T  A  T  I  L  K  R  T  P  T  S  L  A  Q  4
R2      40  T  P  L  H  R  H  D  V  E  Q  D  A  H  Q  A  G  A 24
R3       6   D  P  P  P  P  S  *  S  G  P  R  R  A  S  R  R   28

           ---------|---------|---------|---------|---------|
      2051 gtcgcgttctacctgatcttttccgcagcagccgggcagggctcgctgaa 2100
F1      50   R  V  L  P  D  L  F  R  S  S  R  A  G  L  A  E   65
F2      58 V  A  F  Y  L  I  F  S  A  A  A  G  Q  G  S  L  K  74
F3       4  S  R  S  T  *  S  F  P  Q  Q  P  G  R  A  R  *  R 1
R1       3  T  A  N  *  R  I  K  E  A  A  A  P  C  P  E  S  F 12
R2      23   D  R  E  V  Q  D  K  G  C  C  G  P  L  A  R  Q   8
R3      27 R  R  T  R  G  S  R  K  R  L  L  R  A  P  S  A  S  11

           ---------|---------|---------|---------|---------|
      2101 ggccggagcgctgaccctgctattcgcttttacctatctgtgggtggccg 2150
F1      66 G  R  S  A  D  P  A  I  R  F  Y  L  S  V  G  G  R  82
F2      75  A  G  A  L  T  L  L  F  A  F  T  Y  L  W  V  A  A 91
F3       2   P  E  R  *  P  C  Y  S  L  L  P  I  C  G  W  P   12
R1      11   A  P  A  S  V  R  S  N  A  K  V  *  R  H  T  A   7
R2       7 L  G  S  R  Q  G  Q  *  E  S  K  G  I  Q  P  H  G  7
R3      10  P  R  L  A  S  G  A  I  R  K  *  R  D  T  P  P  R 6

           ---------|-------
      2151 ccaaccagttcctcgag 2167
F1      83  Q  P  V  P  R    87
F2      92   N  Q  F  L  E   96
F3      13 P  T  S  S  S     17
R1       6 A  L  W  N  R  S  1
R2       6  G  V  L  E  E  L 1
R3       5   W  G  T  G  R   1

Data files

   Showorf uses the codon frequency files to translate the sequence.

   The codon usage table is read by default from "Ehum.cut" in the
   'data/CODONS' directory of the EMBOSS distribution. If the name of a
   codon usage file is specified on the command line with the '-cfile'
   option, then this file will first be searched for in the current
   directory and then in the 'data/CODONS' directory of the EMBOSS
   distribution.

   To see the available EMBOSS codon usage files, run:

% embossdata -showall

   To fetch one of the codon usage tables (for example 'Emus.cut') into
   your current directory for you to inspect or modify, run:

% embossdata -fetch -file Emus.cut

Notes

   None.

References

   None.

Warnings

   None.

Diagnostic Error Messages

   None.

Exit status

   It exits with a status of 0. It always exits with status 0.

Known bugs

   None.

See also

   Program name                        Description
   backtranseq  Back translate a protein sequence
   coderet      Extract CDS, mRNA and translations from feature tables
   getorf       Finds and extracts open reading frames (ORFs)
   marscan      Finds MAR/SAR sites in nucleic sequences
   plotorf      Plot potential open reading frames
   prettyseq    Output sequence with translated ranges
   remap        Display sequence with restriction sites, translation etc
   showseq      Display a sequence with features, translation etc
   sixpack      Display a DNA sequence with 6-frame translation and ORFs
   syco         Synonymous codon usage Gribskov statistic plot
   tcode        Fickett TESTCODE statistic to identify protein-coding DNA
   transeq      Translate nucleic acid sequences
   wobble       Wobble base plot

Author(s)

   Alan Bleasby (ajb  ebi.ac.uk)
   European Bioinformatics Institute, Wellcome Trust Genome Campus,
   Hinxton, Cambridge CB10 1SD, UK

History

   1999 - written - Alan Bleasby

Target users

   This program is intended to be used by everyone and everything, from
   naive users to embedded scripts.

Comments

   None
