The EMBOSS Frequently Asked Questions list
==========================================

Last modified: 9 Jan 2003


SECTION A - Help and Support
============================

Q) How do I report bugs ?

A) mail emboss-bug@embnet.org





Q) Are there any mailing lists about EMBOSS?

A) emboss@embnet.org 
   is an open list (anyone can join) for general announcements and
   discussions by end users. 

   emboss-dev@embnet.org 
   is a closed list for discussions by developers using EMBOSS. 
   
   To subscribe to either list, send mail to majordomo@embnet.org
   with the message text subscribe emboss or subscribe emboss-dev 





Q) Where's the documentation?
   
A) All the documentation can be found at the following web page
   http://www.uk.embnet.org/Software/EMBOSS/




Q) Where's the applications' documentation?

A) http://www.uk.embnet.org/Software/EMBOSS/Apps/




Q) Is there a tutorial?

A) Short tutorial:
   http://www.hgmp.mrc.ac.uk/Registered/Help/emboss/short_emboss_tutorial/

   Long tutorial:
   http://www.hgmp.mrc.ac.uk/Registered/Help/emboss/




Q) Is there a quick guide?

A) A revised version is now available incorporating many of the suggestions
   I have had.  In order to get everything on I have shrunk the text to 9pt
   (sorry, no free magnifying glasses) and also prepared a postscript
   version. 

   ftp://ftp.no.embnet.org/embnet/tutorials/EMBOSS_QG.ps  (Postscript file)
   ftp://ftp.no.embnet.org/embnet/tutorials/EMBOSS_QG.doc (Word 97 format- Yuk!)





Q) Is there a table of substitutes for GCG programs?

A) http://www.no.embnet.org/FromGCG.html



Q) Is there a reference I can cite for EMBOSS?

A) Rice,P. Longden,I. and Bleasby,A.
"EMBOSS: The European Molecular Biology Open Software Suite"
Trends in Genetics June 2000, vol 16, No 6. pp.276-277




SECTION B - Installation & Compilation
======================================

Q) How do I compile EMBOSS?

A) Make sure you have the latest code and if you have compiled before
   try the following:-

   rm config.cache    (if that file exists)
   make clean
   ./configure
   make

   If this is the first time trying to compile all you need to do is:-

   ./configure
   make
 
   The above will produce the EMBOSS programs in the 'emboss'
   subdirectory and you can set your PATH variable to point there.
   This method is suitable for EMBOSS developers.

   For system-wide installations we recommend installing the
   EMBOSS programs into a different directory to the source
   code (e.g. in the directory tree /usr/local/emboss). To do
   this type [e.g.]:
      ./configure --prefix=/usr/local/emboss
      make                    [to make sure there are no errors, then]
      make install            [if there are no errors]
   You should then add [e.g.] /usr/local/emboss/bin to your PATH
   variable [e.g.]
      set path=(/usr/local/emboss/bin $path)        [csh/tcsh shells]
      export PATH="$PATH /usr/local/emboss/bin"     [sh/bash shells]


Q) I have an AMD64/Opteron/EM64T system. How do I prevent the compiled
   programs giving segmentation faults?

A) Start with a fresh extraction of the EMBOSS source and, before
   configuring, type (for all the above systems):

   setenv CC "cc -D__amd64__"           [csh/tcsh shells]  or
   export CC="cc -D__amd64__"           [bash/sh]

   Note that the above is case sensitive, there is only one space
   character between the quotes and that there are 4 underscores
   in total (two each side of the amd64).


Q) I have a Linux system and compilation ends prematurely saying that
   it can't find the -lX11 libraries ... but I know I have X11
   installed.

A) You may well have the X11 server installed but you haven't installed
   the X11 development files. For example, on RPM distributions, you need
   to install:
     xorg-x11-devel           (xorg-based X11 distros) or
     XFree86-devel            (XFree86-based X11 distros)
     

Q) I'm trying to compile EMBOSS with the PNG support

A) If you have  gd-1.7.3, zlib-1.1.3 and libpng-1.0.5 or greater
   then the normal configure/compile should work! However, due to gd no longer
   supporting gif format then you may need to install gd, zlib and
   libpng locally.

   You can unpack the tar.gz files in any directory, and install them in
   a common area.

   By default everything (including EMBOSS) installs
   in /usr/local but in the examples below we use /home/joe/local

   Note: gd does not use a ./configure script, and will fail at the
   "make install" stage if the installation directory does not have a
   /bin subdirectory. You can create this directory
   (e.g. /home/joe/local/bin) if it does not already exist.

   To install, pick up the sources (jpeg is optional) and then:

   gunzip -c zlib-1.1.4.tar.gz   | tar xf -
   gunzip -c libpng-1.2.5.tar.gz | tar xf -
   gunzip -c jpegsrc.v6b.tar.gz | tar xf -
   gunzip -c gd-2.0.9.tar.gz     | tar xf -

   ln -s zlib-1.1.4   zlib
   ln -s jpeg-6b jpeg
   ln -s libpng-1.2.5 libpng
   ln -s gd-2.0.9     gd

   If these directories do not exist, "make install" for jpeg will need them:

   mkdir /home/joe/local/bin
   mkdir /home/joe/local/man
   mkdir /home/joe/local/man/man1

   cd zlib
   ./configure --prefix=/home/joe/local
   make
   make install
   cd ..

   cd jpeg
   ./configure --prefix=/home/joe/local
   make
   make test
   make install
   cd ..

   cd libpng
   ./configure --prefix=/home/joe/local

   But this says:

  There is no "configure" script for Libpng-1.2.5.  Instead, please
  copy the appropriate makefile for your system from the "scripts"
  directory.  Read the INSTALL file for more details.

  so copy the file, for example  "cp scripts/makefile.linux makefile"

   ##
   ## edit makefile, change prefix to be /home/joe/local
   ## and any other places - some files point to ../zlib
   ## others use /usr/local/lib and /usr/local/include
   ##
   ## on HP-UX this is trickier. CFLAGS has to match zlib
   ##
   make
   make install
   cd ..

   cd gd
   ##
   ## for 1.x versions, edit Makefile, change:
   ##         INCLUDEDIRS, LIBDIRS, INSTALL_LIB, INSTALL_INCLUDE, INSTALL_BIN
   ##         all          /usr/local
   ##         to           /home/joe/local
   ##
   ## for 2.x versions, we use ./configure (hurrah!)
   ./configure --prefix=/home/joe/local --with-png=/home/joe/local \
               --with-jpeg=/home/joe/local

   make
   make install
   cd ..

   If the gd or jpeg "make install" fails with a warning about the "bin"
   "man" or "man/man1" directory, you need to create it by hand (see above).

   To compile with the local version your EMBOSS ./configure line should now
   read:-
   ./configure --with-pngdriver=/home/joe/local

   This will look for the graphics libraries in your local
   installation under /home/joe/local instead of a system-wide location

   configure keeps a copy of the previous settings. You may need to delete
   file config.cache and config.status if configure has been run before.


Q) When installing EMBOSS recently I get a load of errors due to
   libraries not found.  The main problem is that I have an old version of
   libz but no lib gd in my system libraries and EMBOSS looks there first
   to try to locate these libraries.  I have the correct versions installed
   elsewhere. 

   Deleting -lgd -lz -lpng from CFLAGS in the ajax directory Makefile works
   but is an ugly solution and not really ideal. 

   Are there any suggestions for setting the library search path or am I
   missing something really obvious?

A) There are the
	   --without-pngdriver    
   and
           --with-pngdriver=dir
   flags. Did you try them? If the libraries are in /opt/png/lib then
   set "dir" to /opt/png i.e. one level above the "lib" directory.




Q) Can I get the latest code via CVS ?

A) Yes. Here is the information you will need:-

   Make sure you have cvs on your system Then log into the cvs server at
   'open-bio.org' as: user 'cvs' with password 'cvs'. 

   cvs -d :pserver:cvs@cvs.open-bio.org:/home/repository/emboss login
   The password is 'cvs'

   To checkout the EMBOSS source code tree, put yourself in a local directory
   just above where you want to see the EMBOSS directory created. For example
   if you wanted EMBOSS to be seen as /home/joe/src/emboss... then cd into
   /home/joe/src then checkout the repository by typing: 

   cvs -d :pserver:cvs@cvs.open-bio.org:/home/repository/emboss checkout emboss

   Or if you want to update a previously checked-out source code tree:
   cvs -d :pserver:cvs@cvs.open-bio.org:/home/repository/emboss update

   You can logout from the CVS server with:
   cvs -d :pserver:cvs@cvs.open-bio.org:/home/repository/emboss logout

   (this is a read only server). 





Q) How do i compile the CVS version?

A) You will need automake, autoconf, gmake and libtool for this.

   The gcc compiler is recommended. The host cc compiler should work,
   but there is a problem with automake which generates the Makefiles.
   automake generates dependencies for you, in a '.deps' subdirectory,
   to keep Makefile.in clean, but since automake 1.4 this uses gcc. If
   you are not using gcc, you can use 'automake --include-deps' to
   put the dependencies into each Makefile.in file

   Scripts are available to compile the cvs version.
   
   i.e. source make-static-developers
   will compile a statically linked EMBOSS.

   What this actually does is:-

   aclocal -I m4
   autoconf
   automake -a            #   --include-deps  # if you are not using gcc
   ./configure --disable-shared
   make

   For more info on the configurability of the build try 
   ./configure --help
  

 

Q) Installing associated software MSE.

A)  a) from the anonymous cvs code.
    
       1) Go to the mse directory
       cd embassy/mse

       2) make the configuration file
       aclocal
       autoconf
       automake

       3) configure and compile
       ./configure (use same options as you used to compile emboss)
       make
       make install

    b) from  MSE-0.0.4.tar.gz 

    available from our FTP server ftp://ftp.uk.embnet.org/pub/EMBOSS/ 
    in file MSE-0.0.4.tar.gz 


    If you have done a full installation of EMBOSS using a 'prefix'
    e.g. you configured with ./configure --prefix=/usr/local/emboss
    and followed this with a 'make install' then:

       1) gunzip and untar the file anywhere
       gunzip MSE-0.0.4.tar.gz
       tar xvf MSE-0.0.4.tar

       2) go into the mse directory
       cd MSE-0.0.4

       3) configure using the same prefix and compile [e.g.]:
       ./configure --prefix=/usr/local/emboss
       make
       make install

       N.B. If you configured without using a prefix but did do
            a 'make install' (or specified a prefix of /usr/local,
            which amounts to the same thing) then you must configure
            using:
            ./configure --prefix=/usr/local --enable-localforce


    If, on the other hand, you did not do a 'make install' then:

       1) Go to the emboss directory 
       cd EMBOSS-2.10.0

       2) make new directory embassy if it does not exist already.
       mkdir embassy

       3) Go into that directory
       cd embassy

       4) gunzip and untar the file
       gunzip MSE-0.0.4.tar.gz
       tar xvf MSE-0.0.4.tar

       5) go into the mse directory
       cd MSE-0.0.4

       6) configure and compile
       ./configure (use same options as you used to compile emboss)
       make
       make install
   

 
Q) Installing associated software PHYLIP

A)  a) from the anonymous cvs code.
    
       1) Go to the phylip directory
       cd embassy/phylip

       2) make the configuration file
       aclocal
       autoconf
       automake

       3) configure and compile
       ./configure (use same options as you used to compile emboss)
       make
       make install

    b) from PHYLIP-3.573c.tar.gz 

    available from our FTP server ftp://ftp.uk.embnet.org/pub/EMBOSS/ 
    in file PHYLIP-3.573c.tar.gz 

       1) Go to the emboss directory 
       cd EMBOSS-0.0.4

       2) make new directory embassy if it does not exist already.
       mkdir embassy

       3) Go into that directory
       cd embassy

       4) unzip and untar the file
       gunzip PHYLIP-3.573c.tar.gz
       tar xvf PHYLIP-3.573c.tar

       5) go into the phylip directory
       cd PHYLIP-3.573c

       6) configure and compile
       ./configure (use same options as you used to compile emboss)
       make
       make install



Q) Problems finding PHYLIP acd files ?

A)  The 1.0 release of EMBOSS should be able to find the acd files
    in the install directory or in the original source directory.
    If you have copied the phylip binaries to another location and
    removed these files you can still point to the new ACD directory.

    If you have installed PHYLIP to the same top directory as EMBOSS
    i.e. by default this is usually /usr/local/ (via make install)
    then if you set the following in your .embossrc file then your 
    PHYLIP acd files will be found in
    
    /usr/local/share/EMBOSS/acd/

    if you have not installed PHYLIP then you will can set
    emboss_acdroot to the directory containing the acd files or
    copy them to the emboss/acd directory.

    To tell EMBOSS where to find the files, specify the full path
    of the ACD directory in your ~/.embossrc file, or in the
    emboss.default file.


    env emboss_acdroot /usr/local/share/EMBOSS/acd/

Q) What benefits do i gain from using the associated versions of
    software.

A)  a) You can read any sequence type that emboss can handle.

    b) the associated software will use the emboss acd files so the
    naming of output/input files is taken care of and will check all
    values before the program is run. Command line arguments are used
    instead interactive menu based ones.
    



Q) I have Emboss installed on our development server and I'm preparing a
    dispatch which will send it out to about 20 remote sites. 

    I ran the configure with the --prefix option to install to a private
    directory.  I also collected all the data files (rebase, transfac etc.) to
    another directory and extracted the information from them with the relevant
    programs.

    My intention was to simply transfer the Emboss install directory and the
    Data directory to all sites, using symlinks where necessary so that the
    directory paths corresponded.

    However, when testing this I have found a couple of problems;

    1) Although the Emboss programs work, I can't see any of the extracted
    data.
    For instance remap gives the error;

               EMBOSS An error in remap.c at line 167:
            Cannot locate enzyme file. Run REBASEEXTRACT

    This is despite the fact that I have both the Emboss install and the Data
    directories in the same place as on the development machine (which works).

    2) The other major problem is that I can no longer see my databases defined
    in emboss.default.  Again, the file exists, and is in the same place as on
    the development machine, but the box it is transferred to gives an empty
    list from showdb.

    Does anyone know where Emboss stores the information about the location of
    these files?  It can't have installed anything outside the original
    installation directory (wasn't installed as root), so I'm guessing that the
    problem stems from the program resolving symlinks at some point.

A) It is inside the binaries ...

    EMBOSS 'knows' the location of the files because it is picked up during the
    configure, when you build your copy, and included in the binaries.

    You can see it during compilation, especially of ajnam.c (where it is used):

    -DAJAX_FIXED_ROOT=\"/full/source/path\" -DPREFIX=\"/install/prefix/path\" 

    To copy binaries, you need to define environment variable(s) to
    override the compile-time definitions, unless you can make the path
    (e.g.  /usr/local) the same for the installations at each site. 

    emboss.default can set environment variables too, but you need to tell
    EMBOSS where to find that file. 
         setenv EMBOSS_ROOT /dir/for/default/file

    and then, in the emboss.default file you can set:
         SET EMBOSS_ACDROOT /install/dir/share/EMBOSS/acd

    or (this overrides it) you can use another environment variable:
         SET EMBOSS_ACDROOT /install/dir/share/EMBOSS/acd

    (Peter Rice 22 Nov 2000)


Q) I have downloaded the Emboss source and installed it for use at XYZ
   University without any difficulty.  The administration guide has advice
   on configuring the software using emboss.default, and has examples for
   allowing access to SRS indices.  That appears to be done via the program
   getz, which is not part of the Emboss package. 

A) If you have SRS installed (so you have local SRS index files) you will
   have a local copy of the getz program, which is part of SRS.

   If you do not have SRS, you can build your own index files using dbiflat,
   dbigcg (if you have GCG), dbiblast (if you have blast) and dbifasta. This is
   the usual solution for sites that have no other database indexing in use.

   You can also use SRS servers remotely, to get single entries, using their
   URLs. No extra software is needed (EMBOSS just uses the HTTP protocol).

   Of course, if you really need to build your own SRS indices you
   could install it. SRS is a commercial product, but academic licences are
   available.  But as I now work for the developers of SRS, and this is
   the EMBOSS bug mailing list, I shall say no more :-)

   (Peter Rice 9 Jan 2001)


Q) I am not getting full static files even when I configure with
   --disable-shared

A) This most often happens when using GNU LD. If both shared and
   static versions of a library exist then GNU LD will take the
   shared library as preferred. The root of this problem is libtool.
   You can, however, force complete static images by adding a
   definition to your "make" line: 

   make "LDFLAGS=-Wl,-static"

   (Alan Bleasby 14 Feb 2001)




SECTION C - Graphics
====================



Q) What Graphics options are available?

A) To see what graphics drivers are available type ? at the promt for
   the graph type and this will give you a list.

   Here are some of those:-

   ps      -> Postscript
   cps     -> Colour Postscript
   x11     -> X display. (also called xterm and xwindows)
   hpgl    -> HP Laserjet III, HPGL emulation mode.
   png     -> PNG (you will need png, z and gd libraries for this)
   tek     -> Tektronix Terminal
   none    -> None.
   data    -> Writes out points to a file for graphs.
   meta    -> plplot meta file.




Q) How do i get the PNG driver?

A) To get the PNG driver you will need to have installed z,png and gd
   libraries. In particular gd version >=  1.7.3 must be used.

   If for some reason you do not have the required libraries and your 
   system support group will not update these ( In particular gd, as
   the older versions support GIF which is NOT supported in later
   versions) then install all three latest versions (z,gd,png) to a 
   new directory and then add this new directory to your configure
   line for EMBOSS.

   i.e. 

   make clean
   rm config.cache
   ./configure --with-pngdriver=/home/joe/new

   as i installed gd etc using --prefix=/home/joe/new 
   in the configure of each.

   If you have recently installed the libraries to your system then
   
   make clean
   rm config.cache
   ./configure


   By removing config.cache you are telling the system to check
   again for what is available as these are stored in that file.

   make clean removes all the current objects and EMBOSS libraries
   as these will now need to include the png driver code. 




Q) Where to look for the additional libraries needed for PNG.

A)
   GD)  http://www.boutell.com/gd/
   Z)   http://www.mirror.ac.uk/sites/ftp.cdrom.com/pub/infozip/zlib/
   JPEG) http://www.ijg.org/
   PNG) http://www.mirror.ac.uk/sites/ftp.libpng.org/pub/png/libpng.html

   These also list the various mirror sites for non UK people.

   Alternatively, using ftp :-

   GD)  (boutell.com no longer allows FTP, no known mirror sites, use HTTP)
   Z)   ftp://ftp.info-zip.org/pub/infozip/zlib/zlib-1.1.3.tar.gz
   JPEG) ftp://ftp.uu.net/graphics/jpeg/
   PNG) ftp://swrinde.nde.swri.edu/pub/png/src/libpng.1.2.1.tar.gz



Q) Plotters and pen colours.
    
A) The hp drivers presume the pens are loaded as:-

    SP1     black
    SP2     white
    SP3     red
    SP4     green
    SP5     blue
    SP6     cyan
    SP7     magenta
    SP8     yellow

    Otherwise your output will have different colours.



Q) Browsing the Gnu site I came across libplot, libxmi and plot utils. 
Would these be a suitable replacement for PLPLOT?

A) So far they are still GPL rather than LGPL.

Robert Maier promised a while back to LGPL them but has not yet.  Pity. 
Makes all the difference for linking in third party applications to
EMBOSS. 




Q) I am trying to compile PNG support into EMBOSS on our CTU Unix system.  This
 requires the z, png and gd libraries, which are not on our system at the
 moment.
 
 Does anyone know where I can get these libraries for either OSF or CTU Unix?
 All the references to them I have found on the web have been for Linux.  Are
 these platform independent (so I can use the Linux libraries)?  Or do I need
 specific versions for our unix version?

A) You should be able to compile them from the source on just about any
   Unix platform. 

  http://www.info-zip.org/pub/infozip/zlib/
  http://libpng.sourceforge.net/
  http://www.boutell.com/gd/


Q) I get error messages when I try to display X11 on my PC.
   I am running the Hummingbird Exceed X11 emulator.

A) The Hummingbird Exceed X11 emulator (and maybe other systems) use the
   'TrueColor' display by default. 
   You should change the configuration settings so that it uses 'PseudoColor'.
   In version 6.1 of Hummingbird Exceed, this is done by clicking on the
   Exceed section of the Windows 98 tool bar at the bottom of the screen.
   Select 'Tools', then 'Configuration', then Screen Definition.
   A window will appear.
   In the 'Server Visual' popup menu on the left, select 'PseudoColor'.
   Click on 'OK'.




SECTION D - Data Files
======================



Q) How do I use my own private data file?

A) You may wish to amend one of the standard EMBOSS data files.  One of
  the data files you might wish to alter are the translation table files. 

'transeq' has been written to only read in one of the standard
translation files:

  EGC.0
  EGC.1
  EGC.2
  EGC.3
  EGC.4
  EGC.5
  EGC.6
  EGC.9
  EGC.10
  EGC.12
  EGC.11
  EGC.13
  EGC.14
  EGC.15

These files are the only ones that you can specify to 'transeq'. 

If you wish to create your own specialised translation table, then you
should pick one of them to amend. 

For instance you may decide that you will use the file EGC.15 as you
would never want to use this otherwise. 

Use the program 'embossdata' to get a copy of this file:

% embossdata -fetch -filename EGC.15
Finds or fetches the data files read in by the EMBOSS programs
File '/packages/emboss/emboss/data/EGC.15' has been copied successfully.

Edit the file EGC.15 to suit your requirements.

Specify '-table 15' when you run 'transeq' to use this altered file. 
'transeq' will then look for the file 'EGC.15' and will find it in your
current directory before it finds the default one in the EMBOSS_DATA
directory. It will therefore use your local copy.

You may get confused with many copies of changed files floating about. 
To check which copy of a file is being used - the default EMBOSS_DATA
one or a potential local copy, use 'embossdata':

% embossdata -filename EGC.15
Finds or fetches the data files read in by the EMBOSS programs
# The following directories can contain EMBOSS data files.
# They are searched in the following order until the file is found.
# If the directory does not exist, then this is noted below.
# '.' is the UNIX name for your current working directory.

File ./EGC.15                                            Exists
File .embossdata/EGC.15                                  Does not exist
File /people/gwilliam/EGC.15                             Does not exist
File /people/gwilliam/.embossdata/EGC.15                 Does not exist
File /packages/emboss/emboss/data/EGC.15                 Exists

This shows that a copy of EGC.15 exists in your current directory and so
will be used in preference to the default one in the EMBOSS_DATA
directory. 


SECTION E - Sequence Files and Formats
======================================

Q) How do you write sequences to different files instead of writing them
   all to one file?

A) EMBOSS is not good at writing multiple sequences to different files.
   You could try using 'nthseq' to pull out one sequence at a time.

   You should consider using the '-ossingle' qualifier.  This writes
   sequences to separate FASTA files, but the file names depend on the
   sequence ID.  This is rarely used.  It is there because -ossingle is the
   default for GCG output format.  The output filename is currently ignored
   when ossingle is used, and the filename depends on each individual
   sequence. 




Q) What sequence formats are supported?

A) Many:

   gcg, embl, swissprot, fasta, ncbi, genbank, nbrf, codata, strider,
   clustal, phylip, acedb, msf, ig, staden, text, raw, asis




Q) What is the difference between TEXT and RAW formats?

A) TEXT accepts everything in the sequence file as sequence.
   RAW accepts only alphanumeric and whitespace characters and rejects
   anything else. 



Q) What is ASIS format?

A) The "filename" is really the sequence.
   This is a quick and easy way of reading in a short fragment of
   sequence without having to enter it into a file. 

   For example:
   % program -seq asis::ATGGTGAGGAGAGTTGTGATGAGA




Q) I have some very short protein sequences that EMBOSS thinks are
   nucleic sequences.  How do I force EMBOSS to treat them as nucleic acid
   sequences? 

   For example:
   > cat seq1
   A
   > cat seq2
   I

   % water seq1 seq2 -stdout -auto
   Smith-Waterman local alignment.
   An error has been found: Sequence is not nucleic

   Here, 'water' automatically (and wrongly) thinks that A is adenosine
   instead of alanine and fails when it reads in seq2 and expects to
   find another nucleic acid sequence - but 'I' is not a valid base and
   so it fails. 

A) For many sequence formats there is no way to specify the sequence
   type in the file, so EMBOSS has to guess.

   There is a flag that can force EMBOSS programs to treat sequences as
   nucleic or protein. 

   'water -help -verbose'
   shows the full list of sequence qualifiers.

   If you follow the sequence USA with '-sprotein' EMBOSS will check
   that it is a valid protein sequence. 

   If you need to force a sequence to be DNA, the qualifier is
   '-snucleotide'

   The qualifier must follow the sequence to apply to one sequence, or
   can go at the start of the command line to refer to all sequences, for
   example:

   'water -sprotein seq4 seq3 -stdout -auto'

   You can also use '-sprotein1' anywhere on the command line to refer
   to the first sequence and '-sprotein2' to refer to the second sequence. 

   Of course, like all EMBOSS qualifiers, you can shorten them so long
   as they are still unique.  In this case, '-sp' and '-sn' will work
   (or '-sp1' and '-sp2' if you need the numbers). 







SECTION F - Limits and contraints
=================================

Q) Is there a maximum size for sequences?

A) The maximum size for any program depends only on how much memory your
   system has.

   Of course, some programs (and some program options) can take up too
   much memory, or simply run very slowly. 

   You might have a constraint imposed on your usage of memory.
   Try using the Unix command 'limit' to look at such constraints.
   Try using the Unix command 'unlimit' to remove the constraints, eg:
     % unlimit stacksize
     % unlimit vmemoryuse




Q) GCG has a somewhat arbitrary fragment length limit of 2500 bp for gel*.
   Is there a similar limit for MSE under EMBOSS?

A) No.  MSE has no limit, you are only limited by how much memory you
   have. 





SECTION G - Running under Web servers and from scripts
======================================================


Q) I am trying to write a web interface for an emboss program
   and run apache. The program complains that there is no HOME
   directory set.

A) Just put these at the top after your 'use CGI' ( whatever) statements.

   $ENV{HOME}=<web owner root>  i.e. /usr/local/apache
   $ENV{EMBOSS_DATA}=<emboss data directory>

   These two are important, but you can also pass other "constants". 




SECTION H - Programs and options
================================

Q) Plotting with pepwheel gives interesting output.
   pepwheel -turns=8 -send=30 sw:p77837 -auto
   gives a helical wheel plot but the residues are plotted so every two
   circles are sat on top of one another. 

A) That is the correct answer.

   Instead of 3.6 residues per turn, (5 turns in 18 steps) you seem to
   have a helix with 8 turns in 18 steps (4 in 9).

   Try -turns=4 -steps=9 ... but only if you are sure that is the 
   way your helix goes.

   I suppose we could play with checking for common factors in pepwheel,
   but I don't know of any biologically meaningful setting that would
   cause problems.





Q) In prettyplot, How do you specify an output file name for the plot file?

A) prettyplot -auto ~/wordtest/globin-nogap.msf -graph ps
   Creates prettyplot.ps
   The name is generated automatically.  To set this to something more
   discriptive use -go .i.e

   prettyplot -auto ~/wordtest/globin-nogap.msf -graph ps -go=hello
   Creates hello.ps



Q) In the editor 'mse', but I don't know how to save my edited sequences
   at the end of the editing session. 

A) Use Control-Z to get into command mode.
   Then use the SAVE command which will prompt for the file name.


Q) I would like to know if EMBOSS can perform nucleotide contig assembly
   similar to the function that GCG gelproject/gelview has.  And if yes, is
   there any size restriction on the number of basepair and the number of
   contigs? thank you. 

A) EMBOSS does not cover the sort of contig assembly you describe.  We
   leave that as the province of the Staden package from the LMB in
   Cambridge (down the road).  Rodger Stadens group is developing a GUI
   (Spin) which uses both EMBOSS and his gel assembly programs. 
   (29 Jan 2001)
